View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11104_low_5 (Length: 234)
Name: NF11104_low_5
Description: NF11104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11104_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 39004848 - 39005050
Alignment:
| Q |
18 |
ggagattggtaactgttcaagcttgcaaatgattgatttctttggaaacagtttcaagggggaaattcccatcactattggaaggctaaaagagttgaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39004848 |
ggagattggtaactgttcaagcttgcaaatgattgatttctttggaaacagtttcaagggggaaattcccatcactattggaaggctaaaagagttgaat |
39004947 |
T |
|
| Q |
118 |
ttccttcacctcaggcagaatgagcttgtgggtgagattcctgcaaccttggggaactgtcataaactgaatatcttggatttggctgataatcagctct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39004948 |
ttccttcacctcaggcagaatgagcttgtgggtgagattcctgcaaccttggggaactgtcataaactgaatatcttggatttggctgataatcagctct |
39005047 |
T |
|
| Q |
218 |
ctg |
220 |
Q |
| |
|
||| |
|
|
| T |
39005048 |
ctg |
39005050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 14882949 - 14882747
Alignment:
| Q |
18 |
ggagattggtaactgttcaagcttgcaaatgattgatttctttggaaacagtttcaagggggaaattcccatcactattggaaggctaaaagagttgaat |
117 |
Q |
| |
|
|||||||||||| |||||| ||||||||| ||||||||||||| ||| ||| || |||||| ||||||||||||||| ||| | |||| | |
|
|
| T |
14882949 |
ggagattggtaattgttcagaattgcaaatggttgatttctttggtaaccattttggtggaagaattccaatcactattggaaggttaaggtaattgagt |
14882850 |
T |
|
| Q |
118 |
ttccttcacctcaggcagaatgagcttgtgggtgagattcctgcaaccttggggaactgtcataaactgaatatcttggatttggctgataatcagctct |
217 |
Q |
| |
|
|| ||||| || ||| | ||||| ||||| ||||||||||| || || | ||||| ||||||||||| | | | |||||||||||||||||| | |||| |
|
|
| T |
14882849 |
tttcttcatcttaggtaaaatgatcttgttggtgagattccagctacacttgggaattgtcataaactaagtgtgttggatttggctgataataacctct |
14882750 |
T |
|
| Q |
218 |
ctg |
220 |
Q |
| |
|
||| |
|
|
| T |
14882749 |
ctg |
14882747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University