View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11105_high_18 (Length: 323)
Name: NF11105_high_18
Description: NF11105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11105_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 18 - 166
Target Start/End: Complemental strand, 29336778 - 29336630
Alignment:
| Q |
18 |
ataatccccacttcgatcggaatttaagttaagcctgaccaatggttgttaccgccatggtttgaattcggttactccggattgattagactgttattga |
117 |
Q |
| |
|
|||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||| |
|
|
| T |
29336778 |
ataatccccagtttgatcgaaatttaagttaagcctgaccaatggttgttaccgccatggtttgaattcggctactccgggttgattagaccgttattga |
29336679 |
T |
|
| Q |
118 |
aaattattaactacttaagtcaaatcatttggctatgaagatactatta |
166 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29336678 |
aaattattaactacttaagtcaaatcacttggctatgaagatactatta |
29336630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 199 - 312
Target Start/End: Complemental strand, 29336597 - 29336484
Alignment:
| Q |
199 |
gtactgtcatggttgttagctaattcactttatctaccatcagtctcacaagttatttagttcttggaattcaataatttaagatannnnnnnncattta |
298 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29336597 |
gtactgtcatggttgttagctaactcactttatctaccatcaatctcacaagttatttagttcttggaattcaataatttaagatattttttttcattta |
29336498 |
T |
|
| Q |
299 |
tactagagattcat |
312 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29336497 |
tactagagattcat |
29336484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University