View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11105_high_22 (Length: 277)

Name: NF11105_high_22
Description: NF11105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11105_high_22
NF11105_high_22
[»] chr1 (1 HSPs)
chr1 (196-259)||(6946160-6946223)


Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 196 - 259
Target Start/End: Complemental strand, 6946223 - 6946160
Alignment:
196 atttcgcagccaacatgacaaggatattgagatacaaccaagacgactcaacaatgcaattaac 259  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
6946223 atttcgcagccaacatgataaggatattgagatacaaccaagacgactcaacaatgcaattaac 6946160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University