View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11105_high_25 (Length: 244)
Name: NF11105_high_25
Description: NF11105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11105_high_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 27 - 233
Target Start/End: Original strand, 46213878 - 46214084
Alignment:
| Q |
27 |
ctaaatcaaatggttcgcaccatgcagcggccttagaagaccttaaaataactgagatagaatctgtctcttattgcagctctgagaaggtatgaagcag |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46213878 |
ctaaatcaaatggttcgcaccatgcagcggccttagaagaccttaaaataactgagatagaatctgtctcttattgcagctctgagaaggtatgaagcag |
46213977 |
T |
|
| Q |
127 |
ctggttggttgcgaaaaacggttggagtagttggagggaaagacttgccagctgaaccttctgaagaagattttagaatcggtttgcgcagtggaattgt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46213978 |
ctggttggttgcgaaaaacggttggagtagttggagggaaagacttgccagctgaaccttctgaagaagattttagaatcggtttgcgcagtggaattgt |
46214077 |
T |
|
| Q |
227 |
cctctgt |
233 |
Q |
| |
|
||||||| |
|
|
| T |
46214078 |
cctctgt |
46214084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 111 - 229
Target Start/End: Complemental strand, 37292241 - 37292123
Alignment:
| Q |
111 |
agaaggtatgaagcagctggttggttgcgaaaaacggttggagtagttggagggaaagacttgccagctgaaccttctgaagaagattttagaatcggtt |
210 |
Q |
| |
|
|||||| | ||||||||| ||||||||||||| || |||||| |||||||| |||||| || | ||||||||||||||||||||| |||| | | |
|
|
| T |
37292241 |
agaaggaacgaagcagctagttggttgcgaaatactgttggaaatgttggaggaaaagacatgttggatgaaccttctgaagaagatttcagaaatgcat |
37292142 |
T |
|
| Q |
211 |
tgcgcagtggaattgtcct |
229 |
Q |
| |
|
|||||||||| ||| |||| |
|
|
| T |
37292141 |
tgcgcagtggcattatcct |
37292123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 111 - 202
Target Start/End: Original strand, 39338769 - 39338860
Alignment:
| Q |
111 |
agaaggtatgaagcagctggttggttgcgaaaaacggttggagtagttggagggaaagacttgccagctgaaccttctgaagaagattttag |
202 |
Q |
| |
|
||||| ||||||||||| || |||||| |||||| ||||||||| |||| || ||||| || ||||| || |||||||| ||||| ||||| |
|
|
| T |
39338769 |
agaagatatgaagcagcagggtggttgagaaaaatggttggagttgttgcagctaaagatttaccagcagagccttctgaggaagagtttag |
39338860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University