View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11105_high_28 (Length: 238)
Name: NF11105_high_28
Description: NF11105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11105_high_28 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 31828667 - 31828904
Alignment:
| Q |
1 |
taagctgtgaggttaagaagggtggtaaaggagccagttttgctgcttaatttagaaaagtatggagttcggttattctcgcagatgtggctatgcttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828667 |
taagctgtgaggttaagaagggtggtaaaggagccagttttgctgcttaatttagaaaagtatggagttcggttattctcgcagatgtggctatgcttct |
31828766 |
T |
 |
| Q |
101 |
tgcatggtctcgtgcatttcggaggtggcctgagagtgacagaatgggaggtgtcagttggaggcgtattggactggtagtcttggtttaaatagtattt |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828767 |
tgcatggtctggtgcatttcggaggtggcctgaaagtgacagaatgggaggtgtcagttggaggcgtattggactggtagtcttggtttaaatagtattt |
31828866 |
T |
 |
| Q |
201 |
ttctgcatagtttacagttatgtggctatgagagtggc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828867 |
ttctgcatagtttacagttatgtggctatgagagtggc |
31828904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University