View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11105_low_19 (Length: 323)

Name: NF11105_low_19
Description: NF11105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11105_low_19
NF11105_low_19
[»] chr3 (2 HSPs)
chr3 (18-166)||(29336630-29336778)
chr3 (199-312)||(29336484-29336597)


Alignment Details
Target: chr3 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 18 - 166
Target Start/End: Complemental strand, 29336778 - 29336630
Alignment:
18 ataatccccacttcgatcggaatttaagttaagcctgaccaatggttgttaccgccatggtttgaattcggttactccggattgattagactgttattga 117  Q
    |||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| ||||||||    
29336778 ataatccccagtttgatcgaaatttaagttaagcctgaccaatggttgttaccgccatggtttgaattcggctactccgggttgattagaccgttattga 29336679  T
118 aaattattaactacttaagtcaaatcatttggctatgaagatactatta 166  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||    
29336678 aaattattaactacttaagtcaaatcacttggctatgaagatactatta 29336630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 199 - 312
Target Start/End: Complemental strand, 29336597 - 29336484
Alignment:
199 gtactgtcatggttgttagctaattcactttatctaccatcagtctcacaagttatttagttcttggaattcaataatttaagatannnnnnnncattta 298  Q
    ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||        ||||||    
29336597 gtactgtcatggttgttagctaactcactttatctaccatcaatctcacaagttatttagttcttggaattcaataatttaagatattttttttcattta 29336498  T
299 tactagagattcat 312  Q
    ||||||||||||||    
29336497 tactagagattcat 29336484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University