View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11105_low_20 (Length: 321)
Name: NF11105_low_20
Description: NF11105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11105_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 19 - 304
Target Start/End: Original strand, 49861833 - 49862118
Alignment:
| Q |
19 |
gatcaagcggtcgaatgcgcggtttgtttatcggagtttgaagatggagaaacaggtcgggttttacccaaatgtaatcatagttttcatattgattgta |
118 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49861833 |
gatcaagcggtggaatgcgctgtttgtttatcggagtttgaagatggagaaacaggtcgggttttacccaaatgtaatcatagttttcatattgattgta |
49861932 |
T |
|
| Q |
119 |
ttgatatgtggtttcagtctcattctacatgtccgctttgtagagcgcccgtggaggctgcgccggttcaagcgaccagacaagaagtgacaattgatat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49861933 |
ttgatatgtggtttcagtctcattctacatgtccgctttgtagagcgcccgtggaggctgcgccggttcaagcgaccagacaagaagtgacaattgatat |
49862032 |
T |
|
| Q |
219 |
gtgtgaaccggaattggttttgggttcgagttctggtgatgaaatgaaccagtctgtatcggaattttcttcttcttgttcttcct |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49862033 |
gtgtgaaccggaattggttttgggttcgagttctggtgaagaaatgaaccggtctgtatcggaattttcttcttcttgttcttcct |
49862118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 31 - 170
Target Start/End: Complemental strand, 13998998 - 13998859
Alignment:
| Q |
31 |
gaatgcgcggtttgtttatcggagtttgaagatggagaaacaggtcgggttttacccaaatgtaatcatagttttcatattgattgtattgatatgtggt |
130 |
Q |
| |
|
||||| || |||||||| ||||| |||||| || ||||| |||||||||||||||||||| || ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
13998998 |
gaatgtgctgtttgtttgtcggaatttgaatccggtgaaacgggtcgggttttacccaaatgcaaacatagttttcatactgagtgtattgatatgtggt |
13998899 |
T |
|
| Q |
131 |
ttcagtctcattctacatgtccgctttgtagagcgcccgt |
170 |
Q |
| |
|
|||| |||||| || ||||| |||||| | |||||||| |
|
|
| T |
13998898 |
ttcattctcatgacacgtgtcctctttgtcgggcgcccgt |
13998859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 80 - 161
Target Start/End: Complemental strand, 8434469 - 8434388
Alignment:
| Q |
80 |
ttttacccaaatgtaatcatagttttcatattgattgtattgatatgtggtttcagtctcattctacatgtccgctttgtag |
161 |
Q |
| |
|
||||||| ||||| |||||| | |||||| | ||||||||||||||||||||||| ||||||||||| ||||| |||||||| |
|
|
| T |
8434469 |
ttttaccaaaatgcaatcatgggtttcatttagattgtattgatatgtggtttcaatctcattctacttgtcctctttgtag |
8434388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University