View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11105_low_24 (Length: 275)
Name: NF11105_low_24
Description: NF11105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11105_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 5 - 259
Target Start/End: Complemental strand, 8943693 - 8943452
Alignment:
| Q |
5 |
aatatggattatgtggggtagggcttttagtatcaattgtggtatgcaatatgcatgaacatactcttttacacattaatgattgcaaatagtttcataa |
104 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8943693 |
aatatggattatgtggggtagggctgttagtatcaattgtggtatgcaatatgcatgaacatactcttttacacattaatgattacaaatagtttcataa |
8943594 |
T |
 |
| Q |
105 |
aggatcttgtagtttcatttcattcggtaataagaacacattgcaaaatgcaaacctacaaagcacttcactcaaattcaagactctgatcaaacagggt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8943593 |
aggatcttgtagtttcatttcattcggtaataagaacacattg-------caaaccta------acttcactcaaattcaagactctgatcaaacagggt |
8943507 |
T |
 |
| Q |
205 |
ctgcactatagcattgatatgatgtttggattcaatatgatgttcagtcatttgt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8943506 |
ctgcactatagcattgatatgatgtttggattcaatatgttgttcagtcatttgt |
8943452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University