View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11106_high_13 (Length: 250)
Name: NF11106_high_13
Description: NF11106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11106_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 27475287 - 27475525
Alignment:
| Q |
1 |
ttcattgttcatccaaccccctaaaatgttccattctctcgctatttctttacatttctcaaactatttgcttccaccttctcacatttcgatctcacac |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27475287 |
ttcattgttcatccaaccccccaaaatgttccattctctcgctatttctttacatttctcaaactatttgcttccaccttctcacatttcgatctcacac |
27475386 |
T |
|
| Q |
101 |
tttttggtatataatgattcaactttgaacct-aatacttaatcttttcatttgatcctgttattacagtcaaattgtcct-ggggttcgtatgtcctct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
27475387 |
tttttggtatataatgattcaactttgaacctgaatatttaatcttttcatttgatcctgttactacagtcaaattgtcctgggggttcgtatctcctct |
27475486 |
T |
|
| Q |
199 |
tccttcccggtgtagctttcaagctttttgtgtttttct |
237 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
27475487 |
tccttcccggtgtggctttcaagttttttgtgtttttct |
27475525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University