View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11106_high_9 (Length: 284)
Name: NF11106_high_9
Description: NF11106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11106_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 10930941 - 10930826
Alignment:
| Q |
1 |
ctcaccttcttttccacctttcttttctctctatgcaattctctcaccacccaaatcacatcattcacactcaattcaattccacaactttgatccaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10930941 |
ctcaccttcttttccacctttcttttctctctatgcaattctctcaccccccaaatcacatcattcacactcaattcaattccacaactttgatccaata |
10930842 |
T |
 |
| Q |
101 |
tcaaatacttggaaaa |
116 |
Q |
| |
|
|| || |||||||||| |
|
|
| T |
10930841 |
tcgaacacttggaaaa |
10930826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 191 - 274
Target Start/End: Complemental strand, 10930754 - 10930671
Alignment:
| Q |
191 |
gtccaatctatctccgtttccgataatctcatcctcattgccgccaccactcataatctcaccccagcactctcccatcctttg |
274 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10930754 |
gtccaatctatctccgtctccgataatctcatcctcctcgccgccaccactcataatctcaccccagcactatcccatcctttg |
10930671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University