View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11106_low_11 (Length: 265)
Name: NF11106_low_11
Description: NF11106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11106_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 25 - 253
Target Start/End: Original strand, 40978664 - 40978892
Alignment:
| Q |
25 |
ttatttaatgcatcagaaacaccgtttaacatgatcctaaattataatcaatttattcaaaatcaaacttacaccaatgctatacttggttgggtgttgg |
124 |
Q |
| |
|
||||||| ||| ||| |||||| | |||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40978664 |
ttatttagtgcctcaaaaacactggttaacatgatattaaattataatcaattcattcaaaatcaaacatacaccaatgctatacttggttgggtgttgg |
40978763 |
T |
 |
| Q |
125 |
agtattctttcttgtgttccaagacttaaaaaaggtgaaaatatagaagctcgagtttggagcattaaccaaacgcaaggtgggggaattttccaacttg |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40978764 |
agtattctttcttgtgttccaagacttaaaaaacttgaaaatatagaagctcgagtttggagcattaaccaaacgcaaggtgggggaattttccaacttg |
40978863 |
T |
 |
| Q |
225 |
attccattcgagtttagtcttcctttgct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40978864 |
attccattcgagtttagtcttcctttgct |
40978892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University