View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11106_low_17 (Length: 238)
Name: NF11106_low_17
Description: NF11106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11106_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 73 - 219
Target Start/End: Complemental strand, 52380386 - 52380240
Alignment:
| Q |
73 |
cctcaagttgcaaaaataagtgacgagataatgattctagagttatctcgctatctagcttgaatgaaaggacgcataatatctttctttgccttatgtt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52380386 |
cctcaagttgcaaaaataagtgacgagataatgattctagagttatctcgctatctagcttgaatgaaaggacgcataatatctttctttgcctcatgtt |
52380287 |
T |
|
| Q |
173 |
gttaccgaatataatgactataacagtgggaattggtatctaatccc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380286 |
gttaccgaatataatgactataacagtgggaattggtatctaatccc |
52380240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 14 - 52
Target Start/End: Complemental strand, 52380438 - 52380400
Alignment:
| Q |
14 |
atgaatataatgatgtgatcgagaaaaaagagtaagtag |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380438 |
atgaatataatgatgtgatcgagaaaaaagagtaagtag |
52380400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University