View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11107_low_3 (Length: 233)
Name: NF11107_low_3
Description: NF11107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11107_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 221
Target Start/End: Complemental strand, 36362984 - 36362773
Alignment:
| Q |
10 |
gcacagaactaaaacagaaccatgatgctagtactctactacacctcttgatgagtgtgaatcttgtgaccgggctttaaattccattccattccattca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36362984 |
gcacagaactaaaacagaaccatgatgctagtactctactacacctcttgatgagtgtgaatcttgtgaccgggctttaaattccattccattccattca |
36362885 |
T |
|
| Q |
110 |
catggttctgtttggtagcattaaatatgcaatttaagacagtatgctttatatttttgacaaaggtaaagtgcatcatgagacataaatttactgccaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36362884 |
catggttctgtttggtagcattaaatatgcaatttaagacagtatgctttatatttttgacaaaggtaaagtgcatcatgagacataaatttactgccaa |
36362785 |
T |
|
| Q |
210 |
agagatgaaaaa |
221 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
36362784 |
agagataaaaaa |
36362773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University