View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11108_high_14 (Length: 305)
Name: NF11108_high_14
Description: NF11108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11108_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 36703160 - 36703447
Alignment:
| Q |
1 |
agaacgattatctttcagtttgggatacatatagcactttgaaaggtctaattaacttggaatccacatgttgggccctttcttttttgtttgaaaaatc |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36703160 |
agaacgattatcttttagtttgggatacatatagcactttgaaaggtctaattaacttggaatccacatgttgggccctttcttttttgtttaaaaaatc |
36703259 |
T |
|
| Q |
101 |
ccaatattcaatctttgacttctattgatttgatatgatatactatatgattgttgggttataaatatgaagctaatcaatagtttgccaaaaaatgttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36703260 |
ccaatattcaatctttgacttctattgatttgatatgatatactatatgattgttgggttataaatatgaagctactcaatagtttgccaaaaaatgttg |
36703359 |
T |
|
| Q |
201 |
aaacagatgttgtgtttgtttgggagaatttgaggtgaaggaagagttgctacagattccatattgcaaacatgtgttccacattgat |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36703360 |
aaacagatgttgtgtttgtttgggagaatttgaggtgaaggaagagttgctacagattccatattgcaaacatgtgttccacattgat |
36703447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University