View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11108_low_17 (Length: 285)
Name: NF11108_low_17
Description: NF11108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11108_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 20 - 270
Target Start/End: Complemental strand, 6992369 - 6992119
Alignment:
| Q |
20 |
agaatctgtttccggcgacaaccgcatttatcaccgctcttcatcaacgcagaactcgctttcacagccaatgcagccatttcttgagcttgtaaaggtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6992369 |
agaatctgtttccggcgacaaccgcatttatcaccgctcttcatcaacgcagaactcgctttcacagccaatgcagccatttcttgagcttgtaaaggtt |
6992270 |
T |
|
| Q |
120 |
gccgtaaccagctcaaaggaagtgcgaagtaaagctgtcctggttgtaaagtttggttttcgtcgacggcggtgacgacgttgtcgaaatccatttcatc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6992269 |
gccgtaaccagctcaaaggaagtgcgaagtaaagctgtcctggttgtaaagtttggttttcgtcgacggcggtgacgacgtcgtcgaaatccatttcatc |
6992170 |
T |
|
| Q |
220 |
tgcgttgcagatgaaagaagaaggatattgttgaagaaggtaagaaacttt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6992169 |
tgcgttgcagatgaaagaagaaggatattgttgaagaaggtaagaaacttt |
6992119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University