View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11109_high_28 (Length: 244)
Name: NF11109_high_28
Description: NF11109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11109_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 232
Target Start/End: Original strand, 37304256 - 37304471
Alignment:
| Q |
17 |
caatagcgttgctgcaccgtgcaactgttgtaggggatccaagacctcgaatgtatttgttatctcattttttaaccgcatttagttcaaccagattggt |
116 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37304256 |
caatagtgttgttgcaccgtgcaactgttgtaggggatccaagacctcgaatgtatttgttatctcattttttaaccgcatttagttcaaccagattggt |
37304355 |
T |
 |
| Q |
117 |
ctcgatatatgtgtctatcaatcgcaccataaacttggtgtagtttttgaatcaatgcgatgaatgtatacctcttctcgaaggcgagaattttcaatcc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37304356 |
ctcgatatatgtgtctatcaatcgcaccataaacttggtgtagtttttgaatcaatgcgatgaatgtatacctcttctcgaaggcgagaattttcaatcc |
37304455 |
T |
 |
| Q |
217 |
tcaagtgatgtccatc |
232 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
37304456 |
tcaagtgatgttcatc |
37304471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University