View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11109_high_33 (Length: 227)
Name: NF11109_high_33
Description: NF11109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11109_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 122
Target Start/End: Complemental strand, 30860609 - 30860499
Alignment:
| Q |
13 |
gagatgaattggaagatgaagaagataataaaatggaggaa-tgatgatcccttgagtaattatgacctactccaacatgaagtgtttgggaattgagag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30860609 |
gagatgaattggaagatgaagaagataataaaatggaggaaatgatgatcccctgagtaattatgacctactccaacatgaagtgtttgggaattgagag |
30860510 |
T |
 |
| Q |
112 |
aattataatta |
122 |
Q |
| |
|
||||||||||| |
|
|
| T |
30860509 |
aattataatta |
30860499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 42 - 122
Target Start/End: Original strand, 30861599 - 30861680
Alignment:
| Q |
42 |
aaaatggaggaa-tgatgatcccttgagtaattatgacctactccaacatgaagtgtttgggaattgagagaattataatta |
122 |
Q |
| |
|
|||||||||||| |||||||||||| ||| |||||||||| |||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
30861599 |
aaaatggaggaaatgatgatcccttaagtgattatgaccttctccaacatgaattgtttgggaattgagagaattatgatta |
30861680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University