View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11109_high_33 (Length: 227)

Name: NF11109_high_33
Description: NF11109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11109_high_33
NF11109_high_33
[»] chr2 (2 HSPs)
chr2 (13-122)||(30860499-30860609)
chr2 (42-122)||(30861599-30861680)


Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 13 - 122
Target Start/End: Complemental strand, 30860609 - 30860499
Alignment:
13 gagatgaattggaagatgaagaagataataaaatggaggaa-tgatgatcccttgagtaattatgacctactccaacatgaagtgtttgggaattgagag 111  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
30860609 gagatgaattggaagatgaagaagataataaaatggaggaaatgatgatcccctgagtaattatgacctactccaacatgaagtgtttgggaattgagag 30860510  T
112 aattataatta 122  Q
    |||||||||||    
30860509 aattataatta 30860499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 42 - 122
Target Start/End: Original strand, 30861599 - 30861680
Alignment:
42 aaaatggaggaa-tgatgatcccttgagtaattatgacctactccaacatgaagtgtttgggaattgagagaattataatta 122  Q
    |||||||||||| |||||||||||| ||| |||||||||| |||||||||||| ||||||||||||||||||||||| ||||    
30861599 aaaatggaggaaatgatgatcccttaagtgattatgaccttctccaacatgaattgtttgggaattgagagaattatgatta 30861680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University