View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11109_low_31 (Length: 238)
Name: NF11109_low_31
Description: NF11109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11109_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 225
Target Start/End: Complemental strand, 34843578 - 34843364
Alignment:
| Q |
11 |
aagcagagaacgggttaggttagttcacaagtcacaatcaatcaaataaatataaacaatgaatgatacataattaagattaatttttcacttataggct |
110 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34843578 |
aagcaaagaacgggctaggttagttcacaagtcacaatcaatcaaataaatataaacaatgaatgatacataattaagattaatttttcacttataggct |
34843479 |
T |
 |
| Q |
111 |
ctttttatcatgatcaatcacattatacaagataaaattatagggacaatgtggccacttatactgaaaagatagattacatcactaaattatcaagtag |
210 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34843478 |
cttattatcatgatcaatcacattatacaagataaaattatagggacaatgtgcccacttatactgaaaagatagattacatcactaaattatcaagtag |
34843379 |
T |
 |
| Q |
211 |
ctggatgaaattttt |
225 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34843378 |
ctggatgaaattttt |
34843364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University