View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1110_high_13 (Length: 269)
Name: NF1110_high_13
Description: NF1110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1110_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 259
Target Start/End: Complemental strand, 17169267 - 17169038
Alignment:
| Q |
30 |
ggatattttctattgcattggtaatctatgccattggttggtgtaaagaaggatggaatggattgtcttggatggcatttagagaattatgggaatttac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17169267 |
ggatattttctattgcattggtaatctatgccattggttggtgtaaagaaggatggaatggattgtcttggatggcatttagagaattatgggaatttac |
17169168 |
T |
|
| Q |
130 |
caaacttagttttggttcatctgtaatgatctgtttagaacaatggtatactgcttgcattatacttcttgctgggcatcttgataatcctgtgattgct |
229 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17169167 |
caaacttagtcttggttcatctgtaatgatctgtttagaacaatggtatactgcttgcattatacttcttgctggtcatcttgataatcctgtgattgct |
17169068 |
T |
|
| Q |
230 |
gttggttccttttcgatttggtaagaataa |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17169067 |
gttggttccttttcgatttggtaagaataa |
17169038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 51 - 256
Target Start/End: Complemental strand, 17150694 - 17150489
Alignment:
| Q |
51 |
taatctatgccattggttggtgtaaagaaggatggaatggattgtcttggatggcatttagagaattatgggaatttaccaaacttagttttggttcatc |
150 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||||| |
|
|
| T |
17150694 |
taatttatgccattggttggtgtaaagaaggatggaatggattgtcttggatggcatttagagaattatgggaatttactaagctaagttttggttcatc |
17150595 |
T |
|
| Q |
151 |
tgtaatgatctgtttagaacaatggtatactgcttgcattatacttcttgctgggcatcttgataatcctgtgattgctgttggttccttttcgatttgg |
250 |
Q |
| |
|
||||||||| ||||||||||| ||||||||| | |||||| ||||||||||| ||||||||||||||||||||||| ||||||| | ||| |||||| |
|
|
| T |
17150594 |
tgtaatgatttgtttagaacagtggtatactacaatcattatccttcttgctggctatcttgataatcctgtgattgctcttggttcatattcaatttgg |
17150495 |
T |
|
| Q |
251 |
taagaa |
256 |
Q |
| |
|
|||||| |
|
|
| T |
17150494 |
taagaa |
17150489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 34 - 254
Target Start/End: Complemental strand, 17137410 - 17137190
Alignment:
| Q |
34 |
attttctattgcattggtaatctatgccattggttggtgtaaagaaggatggaatggattgtcttggatggcatttagagaattatgggaatttaccaaa |
133 |
Q |
| |
|
|||||||||||| | ||||| |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||| | | |
|
|
| T |
17137410 |
attttctattgctctagtaatttatgtcattggttggtccaaagaaggatggaatggattatcttggatggcatttagggaactatgggaatttacaata |
17137311 |
T |
|
| Q |
134 |
cttagttttggttcatctgtaatgatctgtttagaacaatggtatactgcttgcattatacttcttgctgggcatcttgataatcctgtgattgctgttg |
233 |
Q |
| |
|
|| ||| |||||||||||| |||||| ||||||||||| ||||||| || ||||||||| ||||||||||| || ||||||||||||||||||||| ||| |
|
|
| T |
17137310 |
ctaagtcttggttcatctggaatgatttgtttagaacagtggtatagtgtttgcattatccttcttgctggtcaccttgataatcctgtgattgctcttg |
17137211 |
T |
|
| Q |
234 |
gttccttttcgatttggtaag |
254 |
Q |
| |
|
|||||| ||| |||||||||| |
|
|
| T |
17137210 |
gttcctattcaatttggtaag |
17137190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University