View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1110_high_21 (Length: 251)
Name: NF1110_high_21
Description: NF1110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1110_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 123 - 249
Target Start/End: Complemental strand, 11075050 - 11074924
Alignment:
| Q |
123 |
tttatttatgtcatcttcttcatcttcaaatttatcaaccttcttcatctacattttgacttcaaaagcaaaaagaaatatccatcatatttatctcatc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11075050 |
tttatttatgtcatcttcttcatcttcaaatttatcaaccttcttcatctgcattttgacttcaaaagcaaaaagaaatatccaccatatttatctcatc |
11074951 |
T |
 |
| Q |
223 |
atcttcaaatcttgagaacaagaaaaa |
249 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
11074950 |
atcttcaaatcttgagaacaagaaaaa |
11074924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 139 - 238
Target Start/End: Complemental strand, 11055744 - 11055644
Alignment:
| Q |
139 |
tcttcatcttcaaatttatcaaccttcttcatctacatttt-gacttcaaaagcaaaaagaaatatccatcatatttatctcatcatcttcaaatcttga |
237 |
Q |
| |
|
||||||||||||||| ||||||| |||||| ||| ||| || |||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11055744 |
tcttcatcttcaaatgtatcaactttcttcgtctgcatcttcgacttctaaagaaaaaagaaatatccatcatatttatctcatcatcttcaaatcttga |
11055645 |
T |
 |
| Q |
238 |
g |
238 |
Q |
| |
|
| |
|
|
| T |
11055644 |
g |
11055644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University