View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1110_low_10 (Length: 419)
Name: NF1110_low_10
Description: NF1110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1110_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 11 - 261
Target Start/End: Original strand, 4607841 - 4608087
Alignment:
| Q |
11 |
agaatatatactcaaatgggtttttgaaatgaaactatactcaatgagttttttgaactagaagaaaactctttctaactagctagctcacgggtttctt |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4607841 |
agaaaatatactcaaatgggtttttgaaatgaaactatactcaatgagttttttgaactagaagaaaactctttctaactag----ctcacgggtttctt |
4607936 |
T |
|
| Q |
111 |
tgttttttagtgggtatctttcatacgtaatagtacacattgttccagaaagttttccaattgttgttggaaccatttgacagtgattttttagattgtt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4607937 |
tgttttttagtgggtatctttcatacgtaatagtacacattgttccagaaagttttccaattgttgttggaaccatttgccagtgattttttagattgtt |
4608036 |
T |
|
| Q |
211 |
attgggtgagttgaaagtactttttgaatttaagattagatatcatatgaa |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608037 |
attgggtgagttgaaagtactttttgaatttaagattagatatcatatgaa |
4608087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 306 - 407
Target Start/End: Original strand, 4608132 - 4608233
Alignment:
| Q |
306 |
cctatgattaatgttattatgttttgtctctaattcttgtctctttactatgtaggtgttttagattttgaatgttttagtaactgttggattttttacc |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608132 |
cctatgattaatgttattatgttttgtctctaattcttgtctctttaccatgtaggtgttttagattttgaatgttttagtaactgttggattttttacc |
4608231 |
T |
|
| Q |
406 |
tt |
407 |
Q |
| |
|
|| |
|
|
| T |
4608232 |
tt |
4608233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 325 - 377
Target Start/End: Original strand, 4608236 - 4608288
Alignment:
| Q |
325 |
tgttttgtctctaattcttgtctctttactatgtaggtgttttagattttgaa |
377 |
Q |
| |
|
|||||||||||||||||||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
4608236 |
tgttttgtctctaattcttgtctcttcaatatgaaggtgttttagattttgaa |
4608288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University