View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1110_low_13 (Length: 369)
Name: NF1110_low_13
Description: NF1110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1110_low_13 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 94 - 369
Target Start/End: Original strand, 32643280 - 32643555
Alignment:
| Q |
94 |
gttcatgtatacctcccaagcataaatacattgcatcagagagcgttgcatatataaatatggtattttactaatataaaaccacaactcgccacatctc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32643280 |
gttcatgtatacctcccaagcataaatacattgcatcagagagcgttgtatatataaatatggtattttactaatataaaaccataactcgccacatctc |
32643379 |
T |
|
| Q |
194 |
actttcttctaacgtccctttaacctgtcatcatcatggataggtctttgttcgtcacacagactcctatcaccactgatgagcttaacattttttacca |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32643380 |
actttcttctaacgtccctttaacctgtcatcatcatggataagcctttgtttgtcacacagactcctatcaccactgatgagcttaaccttttttacca |
32643479 |
T |
|
| Q |
294 |
aattgatcgtgagctattttgttttttgatcttcaaacttcaccacgaggtgactcaatctcttctagtcatggct |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32643480 |
aattgatcgtgagctattttgttttttgatcttcaaacttcaccacgaggtgactcaatctcttctagtcatggct |
32643555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University