View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1110_low_19 (Length: 320)
Name: NF1110_low_19
Description: NF1110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1110_low_19 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 98 - 174
Target Start/End: Complemental strand, 51358411 - 51358335
Alignment:
| Q |
98 |
tatcatatcttccatcttcctctttccattttcaagagttaatcccgtcaaccatcattaagtttgatgttaatata |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51358411 |
tatcatatcttccatcttcctctttccattttcaagagttaatcccgtcaaccatcattaagtttgatgttaatata |
51358335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 244 - 320
Target Start/End: Complemental strand, 51358265 - 51358189
Alignment:
| Q |
244 |
aaacttcgaaaagatggatggattatacagagacctactttgaagcttgggaaacaagagcaagggattactactcc |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51358265 |
aaacttcgaaaagatggatggattatacagagacctactttaaagcttgggaaacaagagcaagggattactactcc |
51358189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 248 - 315
Target Start/End: Original strand, 32908574 - 32908641
Alignment:
| Q |
248 |
ttcgaaaagatggatggattatacagagacctactttgaagcttgggaaacaagagcaagggattact |
315 |
Q |
| |
|
||||||| |||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32908574 |
ttcgaaatgatgtctggattatacagagatctactttgaagcttgggaaacaagagcaggggattact |
32908641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 264 - 318
Target Start/End: Complemental strand, 2425372 - 2425318
Alignment:
| Q |
264 |
gattatacagagacctactttgaagcttgggaaacaagagcaagggattactact |
318 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||| ||||||| |||||||||| |
|
|
| T |
2425372 |
gattatacagagacctactttgaagctggggagacaggagcaagagattactact |
2425318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 262 - 314
Target Start/End: Complemental strand, 2428689 - 2428637
Alignment:
| Q |
262 |
tggattatacagagacctactttgaagcttgggaaacaagagcaagggattac |
314 |
Q |
| |
|
||||||||||| |||||||||| |||||| |||| |||||||||| ||||||| |
|
|
| T |
2428689 |
tggattatacaaagacctacttcgaagctagggagacaagagcaaaggattac |
2428637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 248 - 301
Target Start/End: Original strand, 7088922 - 7088975
Alignment:
| Q |
248 |
ttcgaaaagatggatggattatacagagacctactttgaagcttgggaaacaag |
301 |
Q |
| |
|
||||||| || || |||||||| | ||||||||||||||||||||||| ||||| |
|
|
| T |
7088922 |
ttcgaaatgacgggtggattatgcggagacctactttgaagcttgggagacaag |
7088975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 248 - 301
Target Start/End: Complemental strand, 8803392 - 8803339
Alignment:
| Q |
248 |
ttcgaaaagatggatggattatacagagacctactttgaagcttgggaaacaag |
301 |
Q |
| |
|
||||||| || || |||||||| | ||||||||||||||||||||||| ||||| |
|
|
| T |
8803392 |
ttcgaaatgacgggtggattattcggagacctactttgaagcttgggagacaag |
8803339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 262 - 320
Target Start/End: Original strand, 12167260 - 12167318
Alignment:
| Q |
262 |
tggattatacagagacctactttgaagcttgggaaacaagagcaagggattactactcc |
320 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || |||||||| | |||||||||||| |
|
|
| T |
12167260 |
tggattatacaaagacctactttgaagcttggaaagcaagagcatgagattactactcc |
12167318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 247 - 313
Target Start/End: Original strand, 14537246 - 14537312
Alignment:
| Q |
247 |
cttcgaaaagatggatggattatacagagacctactttgaagcttgggaaacaagagcaagggatta |
313 |
Q |
| |
|
|||||||| |||| |||||| ||| |||| |||||||||| ||||| |||||||||||| |||||| |
|
|
| T |
14537246 |
cttcgaaatgatgagtggattttacggagatctactttgaaacttggaaaacaagagcaatggatta |
14537312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University