View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1110_low_20 (Length: 318)
Name: NF1110_low_20
Description: NF1110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1110_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 36 - 241
Target Start/End: Complemental strand, 13669614 - 13669409
Alignment:
| Q |
36 |
aacatcaatcattgatttccattgcatcatgttactttccttccaacctaattttccctccaccggtggtgaattctccgatgagtacgaggagaaactg |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669614 |
aacatcaatcattgatttccattgcatcatgttactttccttccaacctaattttccctccaccggtggtgaattctccgatgagtacgaggagaaactg |
13669515 |
T |
 |
| Q |
136 |
ctgcttccactattgtctgactctgttcctgaaacaggggcatctagtattgctcttggtgatgcttcatcgtcgcttgaaaactgttttttgttattgc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13669514 |
ctgcttccactattgtctgactctgttcctgaaacaggggcatctagtattgctcttggtgatgcttcatcgtcgcttgaaaactgttttttgttattgc |
13669415 |
T |
 |
| Q |
236 |
cctttg |
241 |
Q |
| |
|
|||||| |
|
|
| T |
13669414 |
cctttg |
13669409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University