View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1110_low_24 (Length: 277)
Name: NF1110_low_24
Description: NF1110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1110_low_24 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 13 - 277
Target Start/End: Complemental strand, 43396507 - 43396242
Alignment:
| Q |
13 |
aatatgacagaatatcttcctgatttgtttgcggagttttctcatgtaccaaagagatcttcaccgtagaattcaggtttaccgattgttgcactttcga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43396507 |
aatatgacagaatatcttcctgatttgtttgcggagttttctcatgtaccaaagagatattcaccgtagaattcaggtttaccgattgttgcactttcga |
43396408 |
T |
|
| Q |
113 |
ctttcgatacctgaaccgtacacaaacttgcatatcttgttgcagactccatctctttaggtgaa-aaaaccctcgcaagatcatagattgggatcttat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43396407 |
ctttcgatacctgaaccgtacacaaacttgcatatcttgttgcagactccgtctctttaggtgaaaaaaaccctcgcaagatcatagattgggatcttat |
43396308 |
T |
|
| Q |
212 |
tcgtctctttgtttgtgtcaaaaagcttgttgtatggacaaattccaaccttgtggccatatcttt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43396307 |
tcgtctctttgtttgtgtcaaaaagcttgttgtatggacaaattccaaccttgtggccatatcttt |
43396242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 22 - 76
Target Start/End: Complemental strand, 53666339 - 53666285
Alignment:
| Q |
22 |
gaatatcttcctgatttgtttgcggagttttctcatgtaccaaagagatcttcac |
76 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||| ||||||| ||||||||| |
|
|
| T |
53666339 |
gaatatcttcctgatttgtatgcggaattttctcatgaaccaaagggatcttcac |
53666285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University