View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1110_low_37 (Length: 245)
Name: NF1110_low_37
Description: NF1110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1110_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 29129448 - 29129296
Alignment:
| Q |
1 |
ctctgatttaaattataaataatcacacaacattgtatcaaaagtaaactcatcaaataattgctcgaagtaatggttaattcaaattttattaacatta |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29129448 |
ctctgacttaaattataaataatcacacaacattgtatcaaaagtaaactcatcaaataattgctcgaagtaatggttaattcaaattttattaacatta |
29129349 |
T |
 |
| Q |
101 |
tatgtgtcacaaatcatagtttaactagaaaattatttatgttttccacaaat |
153 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29129348 |
tatgtgtcacaaatcatagttcaactagaaaattatttatgttttccacaaat |
29129296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 157 - 222
Target Start/End: Complemental strand, 29127072 - 29127007
Alignment:
| Q |
157 |
ttaaagaaaattaataagttttagagtcataaatcatagttcaactaataaaaatatcaaaaatac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29127072 |
ttaaagaaaattaataagttttagagtcacaaatcatagttcaactaataaaaatatcaaaaatac |
29127007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University