View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11110_high_8 (Length: 260)

Name: NF11110_high_8
Description: NF11110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11110_high_8
NF11110_high_8
[»] chr8 (1 HSPs)
chr8 (25-251)||(43602083-43602310)


Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 25 - 251
Target Start/End: Complemental strand, 43602310 - 43602083
Alignment:
25 aatacaaacacatgctgagtgttggcatcaataataattttaaagatgaaagtaattgaatggaacccatgcatcagtgtacgacactaacacatgtcag 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43602310 aatacaaacacatgctgagtgttggcatcaataataattttaaagatgaaagtaattgaatggaacccatgcatcagtgtacgacactaacacatgtcag 43602211  T
125 acattagacacatattcaatgtgaaatctccgtacatatgtatgcgcaattctctagctaaaggtaaaggcaatcaa-taacttcagcagaagaagacta 223  Q
    | |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
43602210 atattagacacatattcaatgtgaaatctcggtacatatgtatgcgcaattctctagctaaaggtaaaggcaatcaactaacttcagcagaagaagacta 43602111  T
224 atttctctttaattaatcagtaagaatc 251  Q
    ||||||||||||||||||||||||||||    
43602110 atttctctttaattaatcagtaagaatc 43602083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University