View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11110_low_11 (Length: 250)
Name: NF11110_low_11
Description: NF11110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11110_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 67 - 236
Target Start/End: Original strand, 2084767 - 2084929
Alignment:
| Q |
67 |
tttgttgtgttagttattaggttattgggggtatgattaagatatacgtagtgtcataagtgttactggtatatgaagcgttgaacatggaacatggaac |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2084767 |
tttgttgtgttagttattaggttattgggggtatgattaagatatacgtagtgtcataagtgttactggtatatgaagcgtt-------gaacatggaac |
2084859 |
T |
|
| Q |
167 |
gtgaaagagaattgaaatgtgaagaagaagatatgaaggaagagatcggttattctatggtcaccttgtt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2084860 |
gtgaaagagaattgaaatgtgaagaagaagatatgaaggaagagatcggttattctatggtccccttgtt |
2084929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University