View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11110_low_13 (Length: 237)
Name: NF11110_low_13
Description: NF11110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11110_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 2084652 - 2084526
Alignment:
| Q |
1 |
caacaccctttaacgttaagattgggtgttgtgtcaaaatcgaacccagatgatgcagatgcagactctgggtcgtttttgtttgttgatttttctacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2084652 |
caacaccctttaacgttaagattgggtgttgtgtcaaaatcgaacccagatgatgcagatgcagactctgggtcgtttttgtttgttgatttttctacat |
2084553 |
T |
|
| Q |
101 |
cactctgttcttggcatttaccacaaa |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2084552 |
cactctgttcttggcatttaccacaaa |
2084526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 223
Target Start/End: Complemental strand, 2084465 - 2084430
Alignment:
| Q |
188 |
ctcacacaagctagtgaacttggttgtggtattgtt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2084465 |
ctcacacaagctagtgaacttggttgtggtattgtt |
2084430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University