View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11110_low_14 (Length: 233)
Name: NF11110_low_14
Description: NF11110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11110_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 16 - 132
Target Start/End: Complemental strand, 20659015 - 20658899
Alignment:
| Q |
16 |
cagagacggacactaacaaatatagttacactcaatttcttctatttgtatataaaaaccaaaaataaaattcagagtctatccaagaacttgctatcga |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20659015 |
cagacacggacactaacaaatatagttacactcaatttcttctatttgcatataaaaaccaaaaataaaattcagagtctatccaagaacttgctatcga |
20658916 |
T |
 |
| Q |
116 |
gcaactcatgtagtaag |
132 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
20658915 |
gcaactcatgtagtaag |
20658899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 143 - 219
Target Start/End: Complemental strand, 20658785 - 20658709
Alignment:
| Q |
143 |
cactaatagagggacgaatgtaatttttatctacataacacaaacacatcagattgaatagtacctaatgttgaaaa |
219 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20658785 |
cactaatagagggatgaatgtaatttttatctacataacacaaacacatcagattgaatagtgtctaatgttgaaaa |
20658709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University