View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11110_low_15 (Length: 218)

Name: NF11110_low_15
Description: NF11110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11110_low_15
NF11110_low_15
[»] chr8 (1 HSPs)
chr8 (20-210)||(38243666-38243856)


Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 20 - 210
Target Start/End: Complemental strand, 38243856 - 38243666
Alignment:
20 tcctatcatcaaactcatttctcttctttaatttcatttattgtttgttacnnnnnnnnnatagaagaagaaattgatgatgaatgatgtttgtatagtt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||| |||||||    
38243856 tcctatcatcaaactcatttctcttctttaatttcatttattgtttgttactttttttttatagaagaagaaattgatgatgaatgatgtttttatagtt 38243757  T
120 gaatattgtggaggggaagatgcaatatctgtatgatgaagctggaagacgttaccttgatgcttttgctgggattgttactgtctctgct 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
38243756 gaatattgtggaggggaagatgcaatatctgtatgatgaagctggaagacgttaccttgatgcttttgctgggattgttactgtttctgct 38243666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University