View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11110_low_15 (Length: 218)
Name: NF11110_low_15
Description: NF11110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11110_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 20 - 210
Target Start/End: Complemental strand, 38243856 - 38243666
Alignment:
| Q |
20 |
tcctatcatcaaactcatttctcttctttaatttcatttattgtttgttacnnnnnnnnnatagaagaagaaattgatgatgaatgatgtttgtatagtt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38243856 |
tcctatcatcaaactcatttctcttctttaatttcatttattgtttgttactttttttttatagaagaagaaattgatgatgaatgatgtttttatagtt |
38243757 |
T |
 |
| Q |
120 |
gaatattgtggaggggaagatgcaatatctgtatgatgaagctggaagacgttaccttgatgcttttgctgggattgttactgtctctgct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38243756 |
gaatattgtggaggggaagatgcaatatctgtatgatgaagctggaagacgttaccttgatgcttttgctgggattgttactgtttctgct |
38243666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University