View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11111_low_11 (Length: 258)

Name: NF11111_low_11
Description: NF11111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11111_low_11
NF11111_low_11
[»] chr1 (2 HSPs)
chr1 (3-97)||(11570951-11571045)
chr1 (172-251)||(11570797-11570876)
[»] chr8 (1 HSPs)
chr8 (172-215)||(3713449-3713492)
[»] chr4 (1 HSPs)
chr4 (174-213)||(48462529-48462568)


Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 3 - 97
Target Start/End: Complemental strand, 11571045 - 11570951
Alignment:
3 gaaaccctcactcgcgcattcaaattctcgcgagacgagatattgagatttgaaatgacgcacgcgtgcagagaaagaacaaaatagaatgtgac 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11571045 gaaaccctcactcgcgcattcaaattctcgcgagacgagatattgagatttgaaatgacgcacgcgtgcagagaaagaacaaaatagaatgtgac 11570951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 172 - 251
Target Start/End: Complemental strand, 11570876 - 11570797
Alignment:
172 agattaaggaattgattgaatgaataaaataagttgaagtgtttaagcgctttgtgttttgaagaggtttatgatgatga 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
11570876 agattaaggaattgattgaatgaataaaataagttgaagtgtttaagcgctttgtgtattgaagaggtttatgatgatga 11570797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 172 - 215
Target Start/End: Complemental strand, 3713492 - 3713449
Alignment:
172 agattaaggaattgattgaatgaataaaataagttgaagtgttt 215  Q
    ||||||||||||||||||||| ||||||||||||||||||||||    
3713492 agattaaggaattgattgaattaataaaataagttgaagtgttt 3713449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 48462568 - 48462529
Alignment:
174 attaaggaattgattgaatgaataaaataagttgaagtgt 213  Q
    ||||||||||||||||||| ||||||||||||||||||||    
48462568 attaaggaattgattgaattaataaaataagttgaagtgt 48462529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University