View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11111_low_13 (Length: 242)
Name: NF11111_low_13
Description: NF11111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11111_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 11570661 - 11570440
Alignment:
| Q |
1 |
ctgatcttgtgtaataggcttgaggctaagataagctggaggtgtagtgcgcgcacactgtgatttgaaagtgaggattttattgatttgtgagttcgta |
100 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
11570661 |
ctgatcttgtgtaatgggtttgaggctaagataagctggaggtgtagtgcgcgcacgctgtgatttgaaagtgaggattt-attggtttgtgagttcgta |
11570563 |
T |
 |
| Q |
101 |
gtggacaaacattgctacacgattacattggtaatattgtgaaaattttaaagatatcaaataaaaattattttgttacaaataaattttatataggcac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
11570562 |
gtggacaaacattgctacacgattacattggtaatattgtgaaaattttaaagatatcaaataaaaattattttgttgcaaataaattttatatagccac |
11570463 |
T |
 |
| Q |
201 |
atgtaataagtaacagtaattaa |
223 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
11570462 |
atgtaataagtaacaataattaa |
11570440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 171
Target Start/End: Complemental strand, 3421398 - 3421349
Alignment:
| Q |
122 |
attacattggtaatattgtgaaaattttaaagatatcaaataaaaattat |
171 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
3421398 |
attacattgctaatattgtgaaatgtttaaaggtattaaataaaaattat |
3421349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University