View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11111_low_7 (Length: 320)
Name: NF11111_low_7
Description: NF11111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11111_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 15 - 305
Target Start/End: Complemental strand, 35516134 - 35515844
Alignment:
| Q |
15 |
catggaagttaggctttcaaactctgaagcggctgaggaaagagcaattttgagtatgcttgcatctgaaatagcaaattcaaaatcagagataaattat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35516134 |
catggaagttaggctttcaaactctgaagcggccgaggaaagagcaattttgagtatgcttgcatctgaaatagcaaattcaaaatcagagataaattat |
35516035 |
T |
 |
| Q |
115 |
ttgttggataaaattcttgaggttgatcttgcttttgcaagagctgcctatgctcaatggatgaatggggtatgcccaattttcagtttaggaactcttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35516034 |
ttgttggataaaattcttgaggttgatcttgcttttgcaagagctgcctatgctcaatggatgaatggggtatgcccaattttcagtttaggaactcttg |
35515935 |
T |
 |
| Q |
215 |
aagtttgtgaatctgttgaaaaggacaatgacatttcagtcgtgcaagatgacgatttaacagtaaatattgaaggtatgcgacacccatt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35515934 |
aagtttgtgaatctgttgaaaaggacaatgacatttcagtcgtgcaagatgacgatttaacagtaaatattgaaggtatgcgacacccatt |
35515844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University