View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11111_low_8 (Length: 297)
Name: NF11111_low_8
Description: NF11111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11111_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 41 - 260
Target Start/End: Complemental strand, 53693477 - 53693258
Alignment:
| Q |
41 |
acttagtttaaaatctgtagacaatacaaagcatcatttattggctacttcatattttcttccaatttcactatattcattttcgtaggaaactaggaat |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53693477 |
acttagtttaaaatctgtagacaatacaaagcatcatttattggctacttcatattttcttccaatttcactatattcattttcgtaggaaactaggaat |
53693378 |
T |
|
| Q |
141 |
agttgaggatgacgactatcctacctatttatcaaatccctttaagcagaagatatgtttgggctgaatggtaggctggattacactagtatatttcaat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53693377 |
agttgaggatgacgactatcctacctatttatcaaatccctttaagcagaagatatgtttgggctgaatggtaggctggattacactagtatatttcaat |
53693278 |
T |
|
| Q |
241 |
tagctatgtttagattatta |
260 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
53693277 |
tagctatgtttagattatta |
53693258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University