View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11112_high_10 (Length: 233)
Name: NF11112_high_10
Description: NF11112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11112_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 14 - 140
Target Start/End: Complemental strand, 43343929 - 43343803
Alignment:
| Q |
14 |
cacagataccaacactaatcgaacggcaagatgagcagcaggatgttgttagtcacacgagacaatgtgctacagcagattcctttctcgattgtgatat |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43343929 |
cacaaataccaacactaatcgaacggcaagatgagcagcaggatgttgttagtcacacgatacaatgtgctacagcagattcctttctcgattgtgatat |
43343830 |
T |
 |
| Q |
114 |
catcattatattgggatatgtgggaag |
140 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43343829 |
catcattatattgggatatgtgggaag |
43343803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University