View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11112_high_10 (Length: 233)

Name: NF11112_high_10
Description: NF11112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11112_high_10
NF11112_high_10
[»] chr2 (1 HSPs)
chr2 (14-140)||(43343803-43343929)


Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 14 - 140
Target Start/End: Complemental strand, 43343929 - 43343803
Alignment:
14 cacagataccaacactaatcgaacggcaagatgagcagcaggatgttgttagtcacacgagacaatgtgctacagcagattcctttctcgattgtgatat 113  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
43343929 cacaaataccaacactaatcgaacggcaagatgagcagcaggatgttgttagtcacacgatacaatgtgctacagcagattcctttctcgattgtgatat 43343830  T
114 catcattatattgggatatgtgggaag 140  Q
    |||||||||||||||||||||||||||    
43343829 catcattatattgggatatgtgggaag 43343803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University