View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11112_high_8 (Length: 247)
Name: NF11112_high_8
Description: NF11112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11112_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 20 - 237
Target Start/End: Original strand, 28803737 - 28803954
Alignment:
| Q |
20 |
gccagatccgtggagatgatgtttcagctgcgtcattttggactatgtgtccttattgttggtatttgcatgaatatgagagaaagtatgaagactgttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28803737 |
gccagatccgtggagatgatgtttcagctgcgtcattttggactatgtgtccttattgttggtatttgcatgaatatgagagaaagtatgaagactgttc |
28803836 |
T |
 |
| Q |
120 |
tcttagatgtgcaaattgtaagaggacatttcacggtacagccgtgaatcccccggattcagagtctatggtggagggaaaggaacaatactattgctat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28803837 |
tcttagatgtgcaaattgtaagaggacatttcacggtacagccgtgaatcccccggattcagagtctatggtggagggaaaggaacaatactattgctat |
28803936 |
T |
 |
| Q |
220 |
catatgagtttgcctttg |
237 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
28803937 |
catatgagtttgcctttg |
28803954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University