View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11112_low_11 (Length: 224)
Name: NF11112_low_11
Description: NF11112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11112_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 13 - 96
Target Start/End: Complemental strand, 39488819 - 39488736
Alignment:
| Q |
13 |
gaagaagagtgaaagaaggttgatgttaattttttacattattatgtgggtgttatggaaagcacaaaatgactggatcttcaa |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39488819 |
gaagaagagtgaaagaaggttgatgttaattttttacattattatgtgggtgttatggaaagcacaaaatgactggatcttcaa |
39488736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 93 - 147
Target Start/End: Complemental strand, 39488697 - 39488643
Alignment:
| Q |
93 |
tcaaagaaatggcatggcattggtttttagctagtctggcaaagtcgtctcttta |
147 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39488697 |
tcaaagagatggcatggcattggtttttagctagtctggcaaagtcgtctcttta |
39488643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 39488616 - 39488567
Alignment:
| Q |
159 |
cgcaatgccttcagtttttaggttctgatagtgttttttcgacttgtttc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39488616 |
cgcaatgccttcagtttttaggttctgatagagttttttcgacttgtttc |
39488567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University