View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11112_low_9 (Length: 236)
Name: NF11112_low_9
Description: NF11112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11112_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 12 - 223
Target Start/End: Original strand, 29087150 - 29087361
Alignment:
| Q |
12 |
tacaattcactgaaacaaaaaggatcaatatctaggaaacatataaacaagtaaagggaatctgtaaggtataacagttttgtatagaaagaattgagaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29087150 |
tacaattcactgaaacaaaaaggatcaatatctaggaaacatataaacaagtaaagggaatctgtaaggtataacagttttgtatagaaagaattgagaa |
29087249 |
T |
|
| Q |
112 |
tagtaggggnnnnnnntagcaggnnnnnnnnnnnnnnnnttgtttgaagcactatagcctatagta-tatacttatataagatttactattctatggatg |
210 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||| |||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
29087250 |
tagtaggggaaaaaaatagcaggcccccctcccctccccttgtttgaagcactatagtctatagtattata-ttatataagatttactattctatggatg |
29087348 |
T |
|
| Q |
211 |
gaaatatggaaag |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29087349 |
gaaatatggaaag |
29087361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University