View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11113_high_13 (Length: 250)
Name: NF11113_high_13
Description: NF11113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11113_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 129 - 246
Target Start/End: Original strand, 440542 - 440659
Alignment:
| Q |
129 |
tgccaagccttttcattttaagtgtttgcataacattttactacctagatgagtaagtgtattttatccattttcagttcaacaaactaattgggtttaa |
228 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
440542 |
tgccaagccttttcattttaagtgcttgcataacattttacaacctagatgagtaagtgtattttatccattttcagtgcaacaaactaattgggtttaa |
440641 |
T |
|
| Q |
229 |
tctatctctgtgctgctc |
246 |
Q |
| |
|
||||||||| || ||||| |
|
|
| T |
440642 |
tctatctctttgatgctc |
440659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 440414 - 440458
Alignment:
| Q |
1 |
ctcactccacacttcattttattgcgttgcaattcgattattagc |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
440414 |
ctcactccacacttcattttattgcgttgcaattcgattattagc |
440458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University