View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11113_high_15 (Length: 237)
Name: NF11113_high_15
Description: NF11113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11113_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 12365897 - 12365674
Alignment:
| Q |
1 |
ttttctatctatataaaggaataagaattacatcatattgttcgtctatactttagagttttagattcatatttcatacgtacggacctaatttgaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
12365897 |
ttttctatctatataaaggaataagaattacatcatattgttcgtctatactttagagttttagattcatatttcatacgtacgtacctgatttgaaaca |
12365798 |
T |
|
| Q |
101 |
ggccacgaatggacttacaaaatacgagtatatgtttgttcatcgagttttcgttaaaatgtaattg-tttaattatggataaactaggtttgttaattg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12365797 |
ggccacgaatggacttacaaaatacgagtatatgtttgttcatcgagttttggttaaaatgtaattgttttaattatggataaactaggtttgttaattg |
12365698 |
T |
|
| Q |
200 |
ttctttattttaacatgagaatat |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
12365697 |
ttctttattttaacatgagaatat |
12365674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University