View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11113_high_7 (Length: 346)
Name: NF11113_high_7
Description: NF11113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11113_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 328
Target Start/End: Complemental strand, 9967356 - 9967028
Alignment:
| Q |
1 |
agtagtaaacgaacatattgaaatctttctttaccctcgtgcgccttcagctgcatatacctttggaaagccgtcaaacatgcccttagcataactaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9967356 |
agtagtaaacgaacatattgaaatctttctttaccctcgtgcgccttcagctgcatatacctttggaaagccgtcaaacatgcccttagcataactaggt |
9967257 |
T |
 |
| Q |
101 |
tgtgcttgaaccctgactttaacagcttcaaatggacatagagctaaattggcaaatacttcagcagatgcactactaa-gaaaatatacaagacttctg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9967256 |
tgtgcttgaaccctgactttaacagcttcaaatggacatagagctaaattggcaaatacttcagcagatgcactactaaggaaaatatacaagacttctg |
9967157 |
T |
 |
| Q |
200 |
tgctggtctaccaatacattggagtaaactcccttaaaatattcatagagaccaaatctgcaccctccttgagcaccgtagccaaagaacttgcctgtcc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9967156 |
tgctggtctaccaatacattggagtaaactcccttaaaatattcatagagaccaaatctgcaccctccttgagcaccgtagccaaagaacttgcctgtcc |
9967057 |
T |
 |
| Q |
300 |
atcctttccacaggacagaaggcccttgt |
328 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9967056 |
atcctttccacaggacagaaggcccttgt |
9967028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University