View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11113_high_9 (Length: 289)
Name: NF11113_high_9
Description: NF11113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11113_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 284
Target Start/End: Original strand, 440141 - 440407
Alignment:
| Q |
18 |
atccagaaccaagggaaaaggaggataattgattaggtctgttctcgatccatctcgctagggtttttgattccgcgagatggcgagttcttcatcttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
440141 |
atccagaaccaagggaaaaggaggataattgattaggtttgttctcgatccatctcgctagggtttttgattccgcgagatggcgagttcttcatcttct |
440240 |
T |
|
| Q |
118 |
agttggcgagagggaatgtcctctgataatatcaaaggtttagttctcgctctttcatccagtttcttcatcggcgctagcttcattgttnnnnnnnngg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
440241 |
agttggcgagagggaatgtcctctgataatatcaaaggtttagttctcgctctttcatccagtttcttcatcggcgctagcttcattgttaaaaaaaagg |
440340 |
T |
|
| Q |
218 |
gtttgaaaaaagccggtgccagtggaatcagagcaggtactccttcgatctcctcactaaattgtct |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
440341 |
gtttgaaaaaagccggtgccagtggaatcagagcaggtactccttcgatctcctcactaaattgtct |
440407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 66 - 245
Target Start/End: Complemental strand, 4891563 - 4891384
Alignment:
| Q |
66 |
tccatctcgctagggtttttgattccgcgagatggcgagttcttcatcttctagttggcgagagggaatgtcctctgataatatcaaaggtttagttctc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4891563 |
tccatctcgctagggtttttgattccgcgagatggcaagttcttcatcttctagttggcgagaaggaatgtcctctgataatatcaaaggtttagttctc |
4891464 |
T |
|
| Q |
166 |
gctctttcatccagtttcttcatcggcgctagcttcattgttnnnnnnnngggtttgaaaaaagccggtgccagtggaat |
245 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
4891463 |
gctcttccatccagtttcttcatcggtgctagcttcattgttaaaaaaaagggtttaaaaaaagcaggtgccagtggaat |
4891384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University