View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11113_low_11 (Length: 262)
Name: NF11113_low_11
Description: NF11113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11113_low_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 13020381 - 13020120
Alignment:
| Q |
1 |
agacaagtattgcatgggagaaccaagagggttatggttgtttttaaatagggttttggaaagagagtaaacagaataaactttctagagatatggtaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13020381 |
agacaagtattgcatgggagaaccaagagggttatggttgtttttaaatagggttttggaaagagagtaaatagaataaactttctagagatatggtaaa |
13020282 |
T |
 |
| Q |
101 |
ctagtgttcccaaattagggttagaaattttatactagtgtgtacatgtttcaagtgagagaaagatataaaactttgtgttttgtttttgaccatataa |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13020281 |
gtagtgttcccacattagggttagaaatttcatactagtgtgtgcatgtttcaagtgagagaaagatataaaactttgtgttttgtttttgaccatataa |
13020182 |
T |
 |
| Q |
201 |
gactgtcagtgcaaaagtttagtattattttaattttcgtagcagagatagatttcttttgt |
262 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13020181 |
gactgtcagtgcaaaagtttagtaatattttaatttttgtagcagagatagatttcttttgt |
13020120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University