View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11113_low_12 (Length: 258)
Name: NF11113_low_12
Description: NF11113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11113_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 22 - 250
Target Start/End: Original strand, 43234996 - 43235208
Alignment:
| Q |
22 |
gaacaatgaaaacttcatatgatggaaacatcattgtgttgttggcgtgacttaaagaagtggcggcttgagtggtggagagaatcggcgggggtgtagc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43234996 |
gaacaatgaaaacttcatatgatggaaacatcattgtgttgttggcgtgacttaaagaagtggcggcttgagtggtggagagaatcggcgggggt----- |
43235090 |
T |
 |
| Q |
122 |
tgcagttgaattcatattcacaatgagataaagttgttgtgagagtttattggatcggagtgacatgagagtgttgattaaggctatcccaaaaataata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43235091 |
-----------tcatattcacaatgagataaagttgttgtgagagtttattggatcggagtgacatgtgagtgttgattaaggctatcccaaaaataata |
43235179 |
T |
 |
| Q |
222 |
cacttaccatgttctatagcttctctgct |
250 |
Q |
| |
|
|||||||||||||| ||||||||| |||| |
|
|
| T |
43235180 |
cacttaccatgttccatagcttctttgct |
43235208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University