View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11114_low_11 (Length: 243)
Name: NF11114_low_11
Description: NF11114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11114_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 21390644 - 21390859
Alignment:
| Q |
18 |
aacaaccggcggggagcacctcacgatcgcgcacagtaactaggagtccccnnnnnnnnnnnnnnnnacaccaaaggcaaacttcaattcacaatcgaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21390644 |
aacaaccggcggggagcacctcacgatcgcgcacagtaactaggagtccctttttttttttttttttacaccaaaggcaaacttcaattcacaatcgaac |
21390743 |
T |
 |
| Q |
118 |
ttacactttatgatatgaaggcaacccaaagaatagacaggtaggagcctattcacgcgcctatcgatcaatgtaatccaactagtaactagtgccctta |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21390744 |
ttagactttatgatatgaaggcaacccaaagaatagacaggtaggagcctattcacgcgcctatggatcaatgtaacccaactagtaactagtgccctta |
21390843 |
T |
 |
| Q |
218 |
atggacctctcctatg |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
21390844 |
atggacctctcctatg |
21390859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University