View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11115_low_11 (Length: 294)
Name: NF11115_low_11
Description: NF11115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11115_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 31134244 - 31133974
Alignment:
| Q |
1 |
gttgttaccccctagtcctatatcacctagacttaaagttggtatgtatattcacccttctataggnnnnnnnnnactcagatttagttttcccacgtat |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||| |
|
|
| T |
31134244 |
gttgttactgcctagtcctatatcacctagacttaaagttggtatgtatattcacccatctacaggttttt----actcagatttagttttcccacgtat |
31134149 |
T |
|
| Q |
101 |
agaa-aataaaagtgcaaacctaggctttggattcatatgcaggaattatttttgtcagaatatttgttttactaatatgaacaaaattctgctgtgtat |
199 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31134148 |
agaataataaaagtgcaaacctaggctttgaattcatatgcaggaattatttttgtcagaatatttgttttactaatatgaacaaaattctgctgtatat |
31134049 |
T |
|
| Q |
200 |
agtttgcagtaatggtacacattgtcccaatgccactgctgacaatagctcaattatattatccccggcaccagc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
31134048 |
agtttgcagtaatggtacacattgtcccaatgccactgctgacaatagctcaattacattatcctcggcaccagc |
31133974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University