View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11115_low_6 (Length: 394)
Name: NF11115_low_6
Description: NF11115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11115_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 10 - 378
Target Start/End: Complemental strand, 14811346 - 14810978
Alignment:
| Q |
10 |
tttatgtagtctctgatctcactgtgattccgtttttcaagattttgttggcctcttgactgctctgcactatgagattgtgcttaatgatgttgatggc |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14811346 |
tttatttagtctctgatctcactgtgattccgtttttaaagattttgttggcctcttgactgctctgcactatgagattgtgattaatgatgttgatggc |
14811247 |
T |
 |
| Q |
110 |
ttgatcactgttgcaaacattgttaaaatctcttgcttacatttaaagtatcttaagttcattttttcatgtgtttggatcctttgtttttattttctct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14811246 |
ttgatcactgttgcaaacattgttaaaatctcttgcttacatttaaagtatcttaagttcattttttcatgtgtttggatcctttgtttttattttctct |
14811147 |
T |
 |
| Q |
210 |
tcccttaagcttttggctctgtgattttaggttatgtttacgttgagggtgttgatgatataaccatggtgttatttaatccccccatcgctgaatacgt |
309 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14811146 |
tcccttaaggttttggttctgtgattttaggttatgtttacattgagggtgtcgatgatataaccatggtgttatttaatccccccatcgctgaatacgt |
14811047 |
T |
 |
| Q |
310 |
tcagtttaagaataggtttgcttaactctttcatgaggttttggatatttgcagtttacttagtttatg |
378 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14811046 |
tcggtttaagaataggtttgcttaactctttcatgaggttttggatatttgcagtttacttagtttatg |
14810978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University