View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11116_low_11 (Length: 249)
Name: NF11116_low_11
Description: NF11116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11116_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 225
Target Start/End: Original strand, 4252971 - 4253198
Alignment:
| Q |
8 |
gagatgaactaattaccttggaacccgtaggatcactactccaaagaggagtagtgtttgtatcgcaatcgaaacaaacggtagttgttaaccaaatatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4252971 |
gagatgaactaattaccttggaacccgtaggatcactactccaaagaggagtagtgtttgtatcgcaatcgaaacaaacggtaattgttaaccaaatatt |
4253070 |
T |
 |
| Q |
108 |
gcttactctcattcttggatattttggtttgaaacttgggtat---tcgtattcgttagtagtttttattttcttctt---agcagcactagcaac---- |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |||||||||||| | |
|
|
| T |
4253071 |
gcttactctcattcttggatattttggtttgaaacttgggtataattcgtattcggtagtagtttttattttcttcttcttagcagcactagctagcatt |
4253170 |
T |
 |
| Q |
198 |
tgttttcttctttttggcagcactagca |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4253171 |
tgttttcttctttttggcagcactagca |
4253198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University