View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11116_low_14 (Length: 217)
Name: NF11116_low_14
Description: NF11116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11116_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 20 - 205
Target Start/End: Complemental strand, 14105515 - 14105330
Alignment:
| Q |
20 |
tttataacttactttatggaaataaacattgcagatcactacaatactaaatattaacagtaaataagtgatccaaaatgttcaaagccatataggaagt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14105515 |
tttataacttactttatggaaataaacattgcagatcactacaatactaaatattaacagtaaataagtgatccaaaatgttcaaagccataaaggaagt |
14105416 |
T |
 |
| Q |
120 |
atacactatactacttaacatatttccaaattgtttcaaacattctaagttacttatttatagccactttgactatcctttgcttc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14105415 |
atacactatactacttaacatatttccaaattgtttcaaacattctaagttacttatttatagccactttgactatcctttgcttc |
14105330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University